// 187. Repeated DNA Sequences
#include "leetcode.h"
/*
* the dna sequence is composed of a series of nucleotides abbreviated as A, C,
* G, and T. when studying dna it is useful to identify repeated sequences
* within the dna. given a string 's' that represents a dna sequence, return all
* the 10 letter long sequences (substrings) that occur more than once in a dna
* molecule. you may return the answer in any order
*/
int cmp(const void *a, const void *b) { return *(int *)a - *(int *)b; }
int val(char c) {
switch (c) {
case 'A':
return 0;
case 'C':
return 1;
case 'G':
return 2;
case 'T':
return 3;
default:
return -1;
}
}
void decode(char *s, int val) {
int i, rem;
s[10] = '\0';
for (i = 9; i >= 0; --i) {
rem = val % 4;
val /= 4;
switch (rem) {
case 0:
s[i] = 'A';
break;
case 1:
s[i] = 'C';
break;
case 2:
s[i] = 'G';
break;
case 3:
s[i] = 'T';
break;
}
}
}
char **findRepeatedDnaSequences(char *s, int *returnSize) {
int stk0[100000], sp0 = 0, stk1[100000], sp1 = 0, n = strlen(s), code = 0;
if (n < 10) {
*returnSize = 0;
return NULL;
}
for (int i = 0; i < 10; ++i)
code = 4 * code + val(s[i]);
stk0[sp0++] = code;
for (int i = 0; i < n - 10; ++i) {
code = (code & 0x3FFFF) * 4 + val(s[i + 10]);
stk0[sp0++] = code;
}
qsort(stk0, sp0, sizeof(int), cmp);
for (int i = 0, j; i < sp0 - 1; ++i)
if (stk0[i] == stk0[i + 1]) {
stk1[sp1++] = stk0[i];
for (j = i + 1; j < sp0 && stk0[i] == stk0[j]; ++j)
;
i = j - 1;
}
char **ans = (char **)malloc(sp1 * sizeof(char *));
for (int i = 0; i < sp1; ++i) {
ans[i] = (char *)malloc(11 * sizeof(char));
decode(ans[i], stk1[i]);
}
*returnSize = sp1;
return ans;
}
int main() {
char *s1 = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", *s2 = "AAAAAAAAAAAAA";
int rs1, rs2;
char **frds1 = findRepeatedDnaSequences(s1, &rs1);
char **frds2 = findRepeatedDnaSequences(s2, &rs2);
for (int i = 0; i < rs1; i++) {
printf("%s ", frds1[i]); // expect: ["AAAAACCCCC","CCCCCAAAAA"]
free(frds1[i]);
}
printf("\n");
for (int i = 0; i < rs2; i++) {
printf("%s ", frds2[i]); // expect: ["AAAAAAAAAA"]
free(frds2[i]);
}
printf("\n");
free(frds1), free(frds2);
}