repeated_dna_sequences.py (918B)
| # 187. Repeated DNA Sequences
from collections import defaultdict
"""
the dna sequence is composed of a series of nucleotides abbreviated as A, C,
G, and T. when studying dna it is useful to identify repeated sequences
within the dna. given a string 's' that represents a dna sequence, return all
the 10 letter long sequences (substrings) that occur more than once in a dna
molecule. you may return the answer in any order
"""
class Solution(object):
def findRepeatedDnaSequences(self, s):
"""
:type s: str
:rtype: List[str]
"""
seq = defaultdict(int)
for i in range(len(s)):
seq[s[i : i + 10]] += 1
return [key for key, val in seq.iteritems() if val > 1]
if __name__ == "__main__":
obj = Solution()
print(obj.findRepeatedDnaSequences(s="AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"))
print(obj.findRepeatedDnaSequences(s="AAAAAAAAAAAAA"))
|
