From 48154c27a07e1216ae206613e58393aa853e6f38 Mon Sep 17 00:00:00 2001 From: Jack Sangdahl Date: Fri, 30 Aug 2024 18:16:42 -0600 Subject: 187. repeated dna sequences --- repeated_dna_sequences.c | 98 +++++++++++++++++++++++++++++++++++++++++++++++ repeated_dna_sequences.py | 28 ++++++++++++++ 2 files changed, 126 insertions(+) create mode 100644 repeated_dna_sequences.c create mode 100644 repeated_dna_sequences.py diff --git a/repeated_dna_sequences.c b/repeated_dna_sequences.c new file mode 100644 index 0000000..5c7fdcf --- /dev/null +++ b/repeated_dna_sequences.c @@ -0,0 +1,98 @@ +// 187. Repeated DNA Sequences +#include "leetcode.h" + +/* + * the dna sequence is composed of a series of nucleotides abbreviated as A, C, + * G, and T. when studying dna it is useful to identify repeated sequences + * within the dna. given a string 's' that represents a dna sequence, return all + * the 10 letter long sequences (substrings) that occur more than once in a dna + * molecule. you may return the answer in any order + */ + +int cmp(const void *a, const void *b) { return *(int *)a - *(int *)b; } + +int val(char c) { + switch (c) { + case 'A': + return 0; + case 'C': + return 1; + case 'G': + return 2; + case 'T': + return 3; + default: + return -1; + } +} + +void decode(char *s, int val) { + int i, rem; + s[10] = '\0'; + for (i = 9; i >= 0; --i) { + rem = val % 4; + val /= 4; + switch (rem) { + case 0: + s[i] = 'A'; + break; + case 1: + s[i] = 'C'; + break; + case 2: + s[i] = 'G'; + break; + case 3: + s[i] = 'T'; + break; + } + } +} + +char **findRepeatedDnaSequences(char *s, int *returnSize) { + int stk0[100000], sp0 = 0, stk1[100000], sp1 = 0, n = strlen(s), code = 0; + if (n < 10) { + *returnSize = 0; + return NULL; + } + for (int i = 0; i < 10; ++i) + code = 4 * code + val(s[i]); + stk0[sp0++] = code; + for (int i = 0; i < n - 10; ++i) { + code = (code & 0x3FFFF) * 4 + val(s[i + 10]); + stk0[sp0++] = code; + } + qsort(stk0, sp0, sizeof(int), cmp); + for (int i = 0, j; i < sp0 - 1; ++i) + if (stk0[i] == stk0[i + 1]) { + stk1[sp1++] = stk0[i]; + for (j = i + 1; j < sp0 && stk0[i] == stk0[j]; ++j) + ; + i = j - 1; + } + char **ans = (char **)malloc(sp1 * sizeof(char *)); + for (int i = 0; i < sp1; ++i) { + ans[i] = (char *)malloc(11 * sizeof(char)); + decode(ans[i], stk1[i]); + } + *returnSize = sp1; + return ans; +} + +int main() { + char *s1 = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", *s2 = "AAAAAAAAAAAAA"; + int rs1, rs2; + char **frds1 = findRepeatedDnaSequences(s1, &rs1); + char **frds2 = findRepeatedDnaSequences(s2, &rs2); + for (int i = 0; i < rs1; i++) { + printf("%s ", frds1[i]); // expect: ["AAAAACCCCC","CCCCCAAAAA"] + free(frds1[i]); + } + printf("\n"); + for (int i = 0; i < rs2; i++) { + printf("%s ", frds2[i]); // expect: ["AAAAAAAAAA"] + free(frds2[i]); + } + printf("\n"); + free(frds1), free(frds2); +} diff --git a/repeated_dna_sequences.py b/repeated_dna_sequences.py new file mode 100644 index 0000000..175fd9a --- /dev/null +++ b/repeated_dna_sequences.py @@ -0,0 +1,28 @@ +# 187. Repeated DNA Sequences +from collections import defaultdict + +""" +the dna sequence is composed of a series of nucleotides abbreviated as A, C, +G, and T. when studying dna it is useful to identify repeated sequences +within the dna. given a string 's' that represents a dna sequence, return all +the 10 letter long sequences (substrings) that occur more than once in a dna +molecule. you may return the answer in any order +""" + + +class Solution(object): + def findRepeatedDnaSequences(self, s): + """ + :type s: str + :rtype: List[str] + """ + seq = defaultdict(int) + for i in range(len(s)): + seq[s[i : i + 10]] += 1 + return [key for key, val in seq.iteritems() if val > 1] + + +if __name__ == "__main__": + obj = Solution() + print(obj.findRepeatedDnaSequences(s="AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT")) + print(obj.findRepeatedDnaSequences(s="AAAAAAAAAAAAA")) -- cgit v1.2.3